List of top Questions asked in VITEEE, NEET (UG)

For a group of positive charges, which of the following statements is correct?

Two parallel, long wires are kept 0.20 m apart in vacuum, each carrying current of \( x \) A in the same direction. If the force of attraction per meter of each wire is \( 2 \times 10^{-6} \, \text{N} \), then the value of \( x \) is approximately:

The range of \( 2 \left| \sin x + \cos x \right| - \sqrt{2} \) is:

The derivative of  \(\sin^2\)\(( \cot^{-1} {\sqrt {( \frac{1 + x}{1 - x}} })\) with respect to \( x \) is equal to: (a) 0
 

Match List I with List II:

List I		List II
A	Two or more alternative forms of a gene	I	Back cross
B	Cross of F1 progeny with homozygous recessive parent	II	Ploidy
C	Cross of F progeny with any of the parents	III	Allele
D	Number of chromosome sets in plant	IV	Test cross

Choose the correct answer from the options given below:

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25^oC from a pressure of 20 atm to 10 atm is:
(Given R = 2.0 cal K^-1 mol^-1)

When unpolarized light is incident at an angle of 60° on a transparent medium from air, the reflected ray is completely polarized. The angle of refraction in the medium is:

If \(x=5\sin(\pi i+\frac{\pi}{3})m\) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are :

The work function of a substance is 4.0 eV. The longest wavelength of light that can cause photoelectron emission from this substance is approximately:

Evaluate the integral: $\int_{-\pi}^{\pi} x^2 \sin(x) \, dx$

Which of the following is an example of actinomorphic flower?

Given below are two statements :
Statement I: The boiling point of hydrides of Group 16 elements follow the order
H₂O > H₂Te > H₂Se > H₂S.
Statement II: On the basis of molecular mass, H₂O is expected to have lower boiling point than the other members of the group but due to the presence of extensive H-bonding in H₂O, it has higher boiling point.
In the light of the above statements, choose the correct answer from the options given below :

Among Group 16 elements, which one does NOT show -2 oxidation state?

The compound that does not undergo Friedel-Crafts alkylation reaction but gives a positive carbylamine test is :

The solution of the differential equation: \[ x^4 \frac{dy}{dx} + x^3 y + \csc(xy) = 0 \] is equal to:

Lecithin, a small molecular weight organic compound in living tissues, is an example of:

Match List I with List II

List I		List II
A	Pons	I	Provides additional space for Neurons, regulates posture and balance.
B	Hypothalamus	II	Controls respiration and gastric secretions.
C	Medulla	III	Connects different regions of the brain.
D	Cerebellum	IV	Neurosecretory cells

Choose the correct answer from the options given below:

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body :

Match List I with List II

List I		List II
A	α –I antitrypsin	I	Cotton bollworm
B	Cry IAb	II	ADA deficiency
C	Cry IAc	III	Emphysema
D	Enzyme replacement therapy	IV	Corn borer

Choose the correct answer from the options given below:

These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct opisdn:

Spindle fibers attach to kinetochores of chromosomes during

Following are the stages of pathway for conduction of an action potential through the heart
A. AV bundle 
B. Purkinje fibres 
C. AV node 
D. Bundle branches 
E. SA node
Choose the correct sequence of pathway from the options given below

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of: