List of top Biology Questions

Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:

Given below are two statements:
Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
Statement II: The hymen is torn during the first coitus only.
In the light of the above statements, choose the correct answer from the options given below:

What is the fate of a piece of DNA carrying only gene of interest which is transfered in to an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiple and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromasame.
E. It shows ability to replicate.
Choose the correct answer from the options given below:

Identify the set of correct statement:
A. The flowers of Vallisneria are colourful and produce nectar. 
B. The flowers of waterlily are not pollinated by water. 
C. In most of water-pollinated species, the pollen grains are protected from wetting. 
D. Pollen grains of some hydrophytes are long and ribbon like. 
E. In some hydrophytes, the pollen grains are carried passively inside water. 
Choose the correct answer from the options given below

Match List I with List II:

List I		List II
A	Two or more alternative forms of a gene	I	Back cross
B	Cross of F1 progeny with homozygous recessive parent	II	Ploidy
C	Cross of F progeny with any of the parents	III	Allele
D	Number of chromosome sets in plant	IV	Test cross

Choose the correct answer from the options given below:

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below :

Consider an enzyme that follows simple Michaelis-Menten kinetics, and has a $ 𝐾_𝑀 of 5 µ𝑀$. The initial velocity of the reaction will be 10% of the maximum velocity at a substrate concentration of µ𝑀 (rounded off to two decimal places).

Total genetic content of an organism is called

How many ATP molecules are needed as an initial investment in the glycolytic cycle (normal glycolysis)?

Which disease is primarily spread by female Anopheles mosquitoes?

Which one of the following can be explained on the basis of Mendel’s Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in F₂ generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:

Match the terminology in Group I with the stimulus in Group II that generates growth response of plants

Group I	Group II
P. Gravitropism	1. Light
Q. Phototropism	2. Touch
R. Thigmotropism	3. Chemical
S. Chemotropism	4. Gravity

Match the morphology in Group I with the corresponding microorganism in Group II

Group I	Group II
P. Coccus	1. Treponema
Q. Rod	2. Bacillus
R. Comma	3. Neisseria
S. Spiral	4. Vibrio

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

Match List I with List II:

List I		List II
A	Mesozoic Era	I	Lower invertebrates
B	Proterozoic Era	II	Fish & Amphibia
C	Cenozoic Era	III	Birds & Reptiles
D	Paleozoic Era	IV	Mammals

Choose the correct answer from the options given below:

Which of the following are fused in somatic hybridization involving two varieties of plants?

Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. 
Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes. 
In the light of above statements, choose the most appropriate answer from the options given below :

The following are the statements about non- chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal. 
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below:

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body :

Adenine constitutes 0.16 mole fraction in a given single-stranded DNA. What is the mole fraction of uracil in the resultant RNA, if this entire DNA fragment is transcribed?

Which one of the following is not a criterion for classification of fungi?

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

Match List I with List II:

List I		List II
A	Clostridium butylicum	I	Ethanol
B	Saccharomyces cerevisiae	II	Streptokinase
C	Trichoderma polysporum	III	Butyric acid
D	Streptococcus sp.	IV	Cyclosporin-A

Choose the correct answer from the options given below: