Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
- 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
- 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
- 3’ ATCGATCGATCGATCGATCGATCGATCG 5
- 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
The Correct Option is B
Approach Solution - 1
Approach Solution -2
The sequence on the mRNA strand is read from the 5' end to the 3' end, and it forms a complementary sequence to the template DNA strand. To find the corresponding coding strand, you need to match the base pairs according to the rules of complementary base pairing:
mRNA: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'
DNA: 3' TAGCTAGCTAGCTAGCTAGCTAGCTAGC 5'
The coding strand is complementary to the template DNA strand. So, the correct sequence on the coding strand is:
5' ATCGATCGATCGATCGATCGATCGATCG 3'
The correct option is (B): 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
Top NEET Biology Questions
- The chronological order of human evolution from early to the recent is
- Upper part of sea/aquatic ecosystem contains
- Where is respiratory electron transport system (ETS) located in plants ?
- Which among the following are the smallest living cells, known without a definite cell wall, pathogenic to plants as well as animals and can survive without oxygen ?
- Three of the following pairs of the human skeletal parts are correctly matched with their respective inclusive skeletal category and one pair is not matched. Identify the non-matching pair. .
Pair of skeletal parts Category (a)$\,\,$ Sternum and ribs$\,\,$ Axial skeleton (b)$\,\,$ Clavicle and glenoid cavity$\,\,$ Pelvic girdle (c)$\,\,$ Flumerus and ulna$\,\,$ Appendicular skeleton (d)$\,\,$ Malleus and stapes$\,\,$ Ear ossicles
Top NEET Transcription Questions
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’ - Identify the correct statement.
अनुलेखन (ट्रांसक्रिप्शन) इकाई के संदर्भ में निम्नलिखित में से कौन-से कथन सही हैं?
A. डीएनए में अनुलेखन इकाई के मुख्यतया तीन भाग : उन्नायक, संरचनात्मक जीन और समापक होते हैं।
B. कहा जाता है कि उन्नायक, संरचनात्मक जीन के 5'-सिरे की ओर स्थित होता है।
C. उन्नायक एक डीएनए अनुक्रम है जो आरएनए पॉलिमरेज के लिए बंधन स्थल प्रदान करता है।
D. उन्नायक टेम्पलेट और कूटलेखन रज्जुक को परिभाषित करता है।
E. समापक, कूटलेखन रज्जुक के 3'-सिरे की ओर स्थित होता है और यह अनुलेखन प्रक्रिया के समापन को परिभाषित करता है।
नीचे दिए गए विकल्पों में से सही उत्तर का चयन कीजिए :
Top NEET Questions
- A $100.0\, mL$ dilute solution of $Ag ^{+}$is electrolysed for $15.0$ minutes with a current of $1.25 \,mA$ and the silver is removed completely. What was the initial $\left[ Ag ^{+}\right]$?
- The time constant of C-R circuit is
- The chronological order of human evolution from early to the recent is
- The correct Boolean operation represented by the circuit diagram drawn is :
- The driver of a car travelling with speed $30\, m/sec$ towards a hill sounds a horn of frequency $600\, Hz.$ If the velocity of sound in air is $330\, m/s,$ the frequency of reflected sound as heard by driver is